17 / 22
Volume 8
Journal of Biotechnology & Biomaterials
ISSN: 2155-952X
Euro Biotechnology 2018
October 11-12, 2018
October 11-12, 2018 | Moscow, Russia
21
st
European
Biotechnology Congress
conferenceseries
.com
Page 53
Molecular analysis of human parainfluenza viruses (HPIV) associated with acute respiratory
infections (ARI) among children in AL-Muthanna/ Iraq
Mohsen A Alrodhan
2
and
Abrar A Kadim
1
1
Al-Muthanna University, Iraq
2
Al-Qadisiyah University, Iraq
H
uman parainfluenza viruses are important cause of respiratory tract diseases including lower respiratory infections
which is a leading cause of deaths in infants and young children worldwide. This study was conducted among
children in Iraq to evaluate the unclear epidemiological features of human parainfluenza viruses (HPIVs) and their role
in acute respiratory infections (ARIs).Three hundred nasopharyngeal samples were collected fromhospitalized pediatric
patients in Al-Muthanna/Iraq at the period from January toMarch/2015 and screened for HPIVs by reverse transcription
real time-polymerase chain reaction (RT-PCR), specific forward, reverse primer F- ACTGGAAGCACGGAAAGAAG,
R-TTGTTGGTGAGCTTGTTGCC and TaqMan prob 5-FAM-TGAGCTGGAGACATCCACAGCCA-BHQ1-3 were
used for detection of HPIV nucleoprotein (NP) gene. The total percentage of positive results was (45.38%). While the
HPIV-1 virus was the predominate (32.17%) as compare with (13.21%) of HPIV-3 virus. Conventional end point PCR
by using specific forward primer F-GCCCGAGTGTGACAGATGAT and R- GTGTCTCCCGTGAAGACCAG was
applied. Ten randomly selected PCR products were purified, sequenced for GenBank submission, these our clones were
recorded in GenBank with accession numbers (KT763053, KT763054, KT763055, KT763056, KT763057, KT763058,
KT763060, KT763052, KT763059 and KT763061). The result of sequence alignment of our HPIV clones by using
ClustalW2 with global reference strains showed high homology phylogenetic analysis with MEGA V6.0 showed that the
clones of HPIV-3 (KT763052, KT763059, KT763061) were located in the same branch with (EU346887.1, M14552.1,
X04612.1) isolated in Lithuania, Chile, India respectively, and has identity with other global strains isolated in USA,
China andWhile our HPIV-1 (KT763053, KT763054, KT763055, KT763056, KT763057, KT763058, KT763060) located
in the same branch with (JQ901971.1, EU346886.1, M62850.1, M62850.1, M62850.1, M62850.1, M62850.1) isolated in
USA, Lithuania. And related to other strains isolated in USA, Thailand, and Japan real time RT-PCR is beneficial for
epidemiologic studies as well as genotyping of the virus, the results indicate that HPIV is one of the important causative
agents of ARI in infants and young children in Al-Muthanna. This is the first study in Iraq to detect HPIV clones and
confirm homology and to generate sequence data that may help in understanding virus diversity and evolution.
abrarabdulla053@gmail.com moh.alrodhan@gmail.comJ Biotechnol Biomater 2018, Volume 8
DOI: 10.4172/2155-952X-C5-101