Journal of Biotechnology & Biomaterials
Open Access

Abstract

This is a first time report on the molecular taxonomy and spermatozoal ultra structure to elucidate the phylogeny of the freshwater crab, Parasesarma sp. The genomic DNA of the candidate specimen was isolated and purified and the gene for ITS (Internal transcribed spacer) was amplified using the ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (GCTGCGTTCTTCATCGATGC) primers. Sequence comparisons of the amplicons were performed by in silico methods. BLAST and CLUSTAL W alignments have shown 93% identity with the Chinese mitten crab, Eriocheir sinensis with E. rectus, the alignment has shown 96% identity. Ultra structural investigations revealed that the spermatophores of Parasesarma are coenospermic and the spermatozoa displayed typical grapsid (family) features: Presence of a centrally placed operculum filled by an apical button, the loss of acrosome ray zone and the concentric acrosomal zonation, periopercular rim, lateral arms and a long cylindrical capsule have been the signifying features. The distinguishable variations (from other grapsid family members) have been the absence of concentric onion-ring lamellations of the outer acrosome and the tongue and groove connection between the operculum and the acrosomal zonation. Interestingly, the spermatozoa of Parasesarma sp. are encircled individually by an electron-dense protective sheath, which has hardly been reported in any other decapod spermatozoa. The results of the present study not only depict the presence of several grapsid characters in terms of the spermatozoal ultra structure, but it as well reports the occurrence of features unique to the candidate specimen (Parasesarma sp.), the species level identification of which is yet to be accomplished.

Biography

Email: arundhathishyla@gmail.com