Spanish 
Chinese 
Russian 
German 
French 
Japanese 
Portuguese 
Hindi Our Group organises 3000+ Global Conferenceseries Events every year across USA, Europe & Asia with support from 1000 more scientific Societies and Publishes 700+ Open Access Journals which contains over 50000 eminent personalities, reputed scientists as editorial board members.
Open Access Journals gaining more Readers and Citations
700 Journals and 15,000,000 Readers Each Journal is getting 25,000+ Readers
Google Scholar citation report
Citations : 3314
Journal of Biotechnology & Biomaterials received 3314 citations as per Google Scholar report
Indexed In
- Index Copernicus
- Google Scholar
- Sherpa Romeo
- Open J Gate
- Genamics JournalSeek
- Academic Keys
- ResearchBible
- China National Knowledge Infrastructure (CNKI)
- Access to Global Online Research in Agriculture (AGORA)
- Electronic Journals Library
- RefSeek
- Hamdard University
- EBSCO A-Z
- OCLC- WorldCat
- SWB online catalog
- Virtual Library of Biology (vifabio)
- Publons
- Geneva Foundation for Medical Education and Research
- Euro Pub
- ICMJE
Useful Links
Recommended Journals
Related Subjects
Share This Page
In Association with
Molecular and genetic identification of thermophilus allocated from koumiss of the southern region of Kazakhstan
11th World Congress on Biotechnology and Biotech Industries Meet
Anna Chizhayeva, Galina Dudikova, Alma Amangeldi and Svetlana Gubareva
Kazakh Research Institute of the Processing and Food Industry, Kazakhstan
Posters & Accepted Abstracts: J Biotechnol Biomater
Abstract
Koumiss is a traditional drink of Kazakhstan made from the fermented mare's milk and possessing properties valuable and useful to health of the person. From the koumiss prepared in the farm of Almaty region isolate Kum1 was emitted. On morphological and biochemical properties isolate Kum1 was carried to lactococcii, it possessed high antagonistic activity concerning Staphylococcus aureus, Micrococcus luteus, Mycobacterium citreum, Mycobacterium rubrum and was perspective as starting culture for industrial production of koumiss. Identification of isolate Kum1 to a species by means of the analysis of the genes coding 16S of rRNA was carried out. For an operating time of these genes conservative primers 8f, 926r, 1492r and the PCR method were used. Primary screening of the received nucleotide sequence on the GenBank and RDP-II database showed that the studied strain belongs to the following systematic groups: Bacteria: Firmicutes, Bacilli, Lactobacillales, Streptococcaceae and Streptococcus. The analysis of phylogenetic relationship constructed with use of standard strains of closely related bacteria showed that species of Streptococcus salivarius and Streptococcus thermophilus are the closest to the studied strain. On the basis of PCR results with use of species-specific primers SthF (CACTATGCTCAGAATACA) and SthR (CGAACAGCATTGATGTTA) (specific for Streptococcus thermophilus) and Ssa442F (AACGTTGACCTTACGCTAGC) and Ssa2712R (GATTCTGTCAAAGAAGCCAC) (specific for Streptococcus salivarius) the tested strain Kum1 is carried to the species of Streptococcus thermophilus. PCR-fingerprint of the strain Kum1 with use of RAPD primers-M13 (GAGGGTGGCGGTTCT) and 1254 (CCGCAGCCAA) allowed to find formation of a unique set of fragments of DNA, characteristic only for this strain.Biography
Anna Chizhayeva has completed her Doctoral degree from Al-Farabi Kazakh National University. Presently she is the leading Researcher of Laboratory of Biotechnology, Quality and Food Safety of the Kazakh Research Institute of the Overworking and Food Safety. In 2015 she was awarded the rank of Professor of the Russian Academy of Natural Sciences. She has more than 70 papers published to her credit and her area of scientific interest are biology of lactic acid bacteria, their metabolic features, bacteriocins, probiotics, safety of food and food biotechnology.
Email: anna_chizhaeva@mail.ru
