Journal of Infectious Disease and Pathology
Make the best use of Scientific Research and information from our 700+ peer reviewed, Open Access Journals that operates with the help of 50,000+ Editorial Board Members and esteemed reviewers and 1000+ Scientific associations in Medical, Clinical, Pharmaceutical, Engineering, Technology and Management Fields.

Candida parapsilosis Sensu Stricto: A Common Colonizing in Oral Mucosa of Argentine Subjects

Rodriguez L1,2*, Rosa A3 and Jewtuchowicz V4

1Department of Diagnostic Clinic and Semiology, School of Dentistry, Cuenca University, Ecuador

2Researcher for Mycology Center, IMPaM, Buenos Aires University – CONICET, Argentina

3Department of Microbiology and Parasitology, School of Dentistry, Buenos Aires University, Argentina

4Department of Microbiology, Parasitology and Immunology, Buenos Aires University, School of Medicine, IMPaM UBA-CONICET, Argentina

Corresponding Author:
Rodriguez L
Senior Teacher for the Department of Diagnostic Clinic and Semiology, School of Dentistry, Cuenca University , Ecuador
Tel: 5932933554
E-mail: malourdes84@hotmail.com

Received Date: November 02, 2016; Accepted Date: December 06, 2016; Published Date: December 15, 2016

Citation: Rodriguez L, Rosa A, Jewtuchowicz V (2016) Candida parapsilosis Sensu Stricto: A Common Colonizing in Oral Mucosa of Argentine Subjects. J Emerg Infect Dis 1:118. doi: 10.4172/2472-4998.1000118

Copyright: © 2016 Rodriguez L, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Visit for more related articles at Journal of Infectious Disease and Pathology

Abstract

Candida parapsilosis is a complex made up of three species (Candida parapsilosis sensu stricto, C. orthopsilosis and C. metapsilosis) which differ genetically. In Argentina and worldwide, no data is available on the distribution and behavior of the complex in oral cavity niches, and there is little information on its epidemiology.

Aim: To characterize Argentine isolates of the C. parapsilosis complex from different oral cavity sites and other ecological niches.

Methodology: Retrospective, cross-sectional, descriptive study on a collection of isolates which were previously identified by conventional methods as parapsilosis complex, in order to distinguish the species by using end-point PCR with specific primers derived from a single sequence in the ITS1-5.8SrRNA-ITS2 region.

Results: 95% of the isolates were identified as Cp. sensu stricto, which was recovered with higher probability from oral mucosa sites, under pathological conditions, and in presence of intraoral appliances. Seventy-four percent of the strains were recovered under conditions of immunocompetence, and 100% of the isolates had resistant phenotype to flucytosine.

Conclusions: C. parapsilosis sensu stricto is a common species in different ecological niches. It is more likely to be recovered under conditions of immunocompetence. Dysbiosis of the mouth favors the growth of Cp. sensu stricto, which under these conditions may become a source for cross-transmission of more or less virulent strains by direct person-to-person contact, and a potential source of candidemia or invasive infections through hematogenous dissemination of strains with increased pathogenicity.

Keywords

Candida parapsilosis complex; Candida parapsilosis sensu stricto; Oral dysbiosis; Immunological status

Introduction

Results on the distribution of the species in this complex are highly variable, although all the literature we reviewed reports Candida parapsilosis sensu stricto as having the highest prevalence worldwide, and Silva et al. [1] report it as the most frequent isolate in hematogenous infections. The distribution of Candida orthopsilosis and Candida metapsilosis varies widely according to geographic region, clinical service and anatomical site [2,3]. Indeed, Miranda et al. [4] (claim that the exact importance of C. orthopsilosis and C. metapsilosis as human pathogens is as yet uncertain.

Little is known regarding the prevalence of species of the Candida parapsilosis complex in the oral cavity. The few papers published on the subject report variable results on its distribution in this specific ecological niche, and state that C. parapsilosis sensu stricto is the most commonly recovered species in immunocompetent individuals both in Europe and in North America [1,5,6] while C. metapsilosis seems to prevail over C. parapsilosis sensu stricto in immunocompromised patients [7].

Candida parapsilosis is usually susceptible to antifungal agents, but there are reports of isolates with reduced susceptibility to azoles and echinocandins [4]. This has serious clinical implications, since these are the drugs used as first-line agents for the treatment of invasive micosis [1,8].

Despite the importance of C. parapsilosis as a hospital pathogenic fungus, there are few studies, particularly in Latin America, on global epidemiology or on response to antifungal agents of species in this complex, and still less is known regarding its distribution in oral cavity niches. The oral cavity may be a source of candidemias caused by this fungus in patients with risk factors. In Argentina, there is very little information on the distribution and response to antifungal agents of the species in the complex, hence, our aim is to study the prevalence, distribution in the mouth and other ecological niches, and response to antifungal agents of the 3 species in the parapsilosis complex, from a collection of clinical isolates obtained in previous research studies and stored at the Mycological Center at the Buenos Aires University (UBA) School of Medicine.

Materials and Methods

This was a retrospective, cross-sectional, descriptive study using 150 clinical isolates of the parapsilosis complex from oral cavity and other ecological niches, stored in the collection at the IMPAM Mycology Center, School of Medicine, Buenos Aires University (UBA), which were collected during previous research projects from immunocompetent outpatients and hospitalized immunocompromised patients in different clinical situations.

The sample consisted of 101 isolates which were successfully reconstituted, to be analyzed by end-point PCR with specific primers. The following reference strains from the ATCC collection were used: C. parapsilosis (ATCC 22019), C. orthopsilosis (ATCC 96139) and C. metapsilosis (ATCC 96143), on which the same procedures were performed as on the clinical isolates.

For clinical correlation, patient´s clinical records and the dental data of the oral isolates were available.

For the in vitro susceptibility tests, we used Vitek2 automated susceptibility testing cards AST-YS07 to evaluate the response of 50 clinical isolates to the following antifungal agents: fluconazole (FLC), voriconazole (VRC), caspofungin (CASPO), micafungin (MICA) and amphotericin B (AMB). To interpret the readings, we used the 2012 revision of species-specific clinical breakpoints (CBPs) and epidemiological cutoff value (ECV) (Pfaller and Diekema 2012) [9-12] (CLSI, M27-S4/2012). For quality controls for the study we used the following Candida strains: Candida kruse iATCC 6258, C. parapsilosis ATCC 22019 and C. albicans ATCC 9002.

The following variables were analyzed: a) species of the parapsilosis complex; b) oral ecological niche; c) oral clinical status; d) intraoral appliances; e) immunological status; and f) response to antifungal agents.

Reconstitution of clinical isolates

Isolates were initially identified based on the color developed in the chromogenic medium, micro-morphology in 1%-Tween 80 milk agar and carbohydrate assimilation profile using commercial systems API ID 32D and Vitek2 (BioMérieux, France) [7,9].

To reconstitute the isolates, each strain was seeded in the following culture media: 1) BHI (brain-heart infusion) for metabolic activation of strains, incubated at 28°C-37°C for 24-48 h [7]; 2) Differential chromogenic solid medium for Candida (Chromagar), to ascertain the purity of the isolate and discard any contaminated strains, incubated at 28°C for 24 hours [10]; 3) Sabouraud, to amplify colonies, incubated at 28°C-37°C for 24 hours [10]; 4) YPD broth (yeast extract, peptone and glucose) to obtain a more robust culture, for 24 h with shaking at 37°C [10].

Molecular characterization of clinical isolates by end-point PCR with specific primers

Yeast DNA was obtained by breaking down the cell wall with zymolyase to generate spheroplasts (Scherer and Stevens 1987) [11]. Spheroplasts were verified by optical microscopy, after which a column (QUIAM Blood DNA Kit) was used for purifying, following the Qiagen protocol. The DNA obtained was preserved at -20°C.

Molecular typing was done by end-point PCR with specific primers derived from unique sequences contained in the internal transcriptional spacer 1 (ITS 1)-5.8 rRNA-(ITS2) of the fungal ribosomal DNA, which enable species-specific sequences for C. parapsilosis sensu stricto, C. orthopsilosis and C. metapsilosis to be retrieved separately (Table 1) [13,14].

Primer Target gene Direction Species specificity Sequence Amplification size
CPAF ITS 1 Forward C. parapsilosis TTTGCTTTGGTAGGCCTTCTA 379pb
CPAR ITS 2 Reverse GAGGTCGAATTTGGAAGAAGT
CORF ITS 1 Forward C. orthopsilosis TTTGGTGGCCCACGGCCT 367pb
CORR ITS 2 Reverse TGAGGTCGAATTTGGAAGAATT
CMEF ITS 1 Forward C. methapsilosis TTTGGTGGGCCCACGGCT 374pb
CMER ITS 2 Reverse GAGGTCGAATTTGGAAGAATGT

Table 1: Primers used for rapid identification at species level of the C. parapsilosis complex. Source: Asadzadeh M, et al. (2009) [10].

Validation of PCR results with Sanger sequencing

The results of amplification with specific primers were validated with Sanger sequencing, for which an end-point PCR was performed using the pan-fungal primers ITS 1(forward: TCCGTAGGTGAACCTGCGG) and ITS 4 (reverse: TCTTTTCCTCCGCTTATTGATATG) to amplify and then sequence the ITS1-ITS4 region of ribosomal RNA gene 28S, as described by White et al. [2].

These primers amplified a 536 bp fragment from a fungal ribosomal DNA region (Figure 1). The PCR cycles were performed in a MiniCyclerTM, MJ Research INC thermal cycler, under the following protocol: one 5-minute cycle at 95º, followed by 30 3-stage cycles (20 seconds at 95°C//15 seconds at 55°C// 65 seconds at 72° C), and finally, one 5-minute cycle at 72°C [10].

emerging-infectious-diseases-Phylogram-constructed

Figure 1: Phylogram constructed with reference strains and 3 unknown strains.

The amplified fragments were purified using a commercial QIAquick PCR purification Kit (Qiagen), and sequenced using an ABI Prism 3730xl DNA analyzer (AppliedBiosystems, BsAs-Argentina) with the primers ITS1 and ITS4 [10].

Sequence identification and phylogenetic analysis

The sequences obtained were analyzed with the algorithm for sequence comparison BLAST (Basic Local AlignmentSearchTool)/ (http://www.ncbi.nlm.nih.gov/BLAST). To choose the best alignment between query and target sequence, we considered: a) % of identity; b) positive %; c) query coverage; d) and e-value.

For phylogenetic analysis we used the BIOEDIT software for editing sequence alignment and the MEGA 6 software for multiple alignment of sequences and phylogenetic analysis, for which the Neighbour joining algorithm was used. The tree was constructed with the reference ATCC sequences for C. parapsilosis, C. orthopsilosis, C. metapsilosis; in addition to the sequences selected at random from the total which were positive to PCR with specific primers.

Results

Of the total isolates upon which molecular analysis was performed, 96 (95%) were positive for the species C. parapsilosis sensu stricto (Table 2) according to the end-point PCR method with the pair of specific primers CPAR-CPAF, providing 379 bp amplicons (Figures 2-5). This band pattern is compatible to the one published by Asadzadeh et al. in the Journal of Medical Microbiology in 2009 [10]. The 5 remaining strains were negative for all three species of the parapsilosis complex, so they could only be identified by sequencing followed by bioinformatic analysis.

emerging-infectious-diseases-Electrophoretic-run

Figure 2: Electrophoretic run for PCR products from 17 samples from different sites in the oral cavity, showing a 379 bp band pattern.
Note: Mp: weight marker; C+: positive control; C-: negative control.

emerging-infectious-diseases-blood-samples

Figure 3: Electrophoretic run of the PCR products from blood samples, showings a 379 bp band pattern.
Note: Mp: weight marker; C+: positive control; C-: negative control.

emerging-infectious-diseases-ecological-niche

Figure 4: Proportion of C. parapsilosis isolates according to host immunological status per ecological niche.

emerging-infectious-diseases-nail-samples

Figure 5: Electrophoretic run of PCR product from skin/nail samples.
Note: Mp: weight marker; C+: positive control; C-: negative control.

Species AF RF PF CI95%
C. parapsilosis 96 0.95 95% 94.9-95%
C. orthopsilosis 0 0 0 0
C. metapsilosis 0 0 0 0
Others 5 0.05 5% 4.6-5.4%
Total 101 1 100%  

Table 2: Distribution of frequencies for the species in the parapsilosis complex in the collection of clinical isolates.

DNA sequencing study in the ITS region

Of the 96 strains identified by PCR as C. parapsilosis, 3 strains were selected at random to validate by sequencing. The 5 strains that were negative for the 3 species of the C. parapsilosis complex were also sequenced to enable their identification.

The alignment determined 100% identical sequence for C. parapsilosis sensu stricto for all 3 strains (Cp1; Cp17; Cp10.2) selected at random, and which were positive for PCR for said species.

Phylogenetic analysis using MEGA 6 software confirmed the result obtained in BLAST, showing that the unknown strains and reference strain ATCC 22019 were 100% identical, with C. orthopsilosis and C. metapsilosis being more closely related to each other than they were to C. parapsilosis (Figure 1).

The BLAST analysis of the 5 strains that were negative according to PCR for the three strains in the complex determined the following identification:

Cp36A: 100% identical to C. albicans

Cp53.1: 100% identical to C. albicans

Cp78/2.2: 100% identical to C. pararugosa

Cp78PA: 100% identical to Kluyveromyces marxianus

Cp381: 100% identical to C. albicans

Prevalence and distribution of species in the parapsilosis complex according to ecological niche

Oral cavity: Thirty-eight isolates were successfully recovered from oral cavity at the following sites: tongue, cheek, palate, subgingival mucosa and peri-implant mucosa. Of the total C. parapsilosis strains isolated from mouth, 34 (89.5%) were positive for the species C. parapsilosis sensu stricto, while 4 were negative for the three species in the complex.

A higher frequency of isolation of C. parapsilosis was obtained in sites of oral mucosa with respect to subgingival niches. The difference was statistically significant and clinically relevant (Table 3).

Type of oral niche C. parapsilosis sensu strictoN(%)
Oral mucosa 24 (70.6)
Gingival sulcus 10 (29.4)
Total 34 (100)

Table 3: Probability per ecological niche.

There is almost 4 times more probability of recovering C. parapsilosis of buccal cavity in pathological conditions than in health condition. The difference was statistically significant and clinically relevant (Table 4).

Oral condition C. parapsilosissensu stricto N(%)
With SF 27 (79.4)
Without SF 7 (20.6)
Total 34 (100)

Table 4: Probability per oral clinical condition.

The probability of recovering C. parapsilosis from the oral cavity with the presence of artifices is almost 3 times higher than in the absence of these. The difference was statistically significant and clinically relevant (Table 5).

Intraoral appliances C. parapsilosissensu stricto N(%)
With 25 (73.5)
Without 9 (26.5)
Total 34(100)

Table 5: Probability according to presence/absence of intraoral appliances.

All (100%) isolates from oral cavity were obtained from immunocompetent patients.

Other niches

Blood: 25 (25/101) isolates from patients with candidemias were analyzed, of which 24 (96%) were positive for the species C. parapsilosis sensu stricto. Only one isolate was negative for the three species in the complex, which was identified by sequencing as C. albicans.

Out of the total isolates from blood characterized as C. parapsilosis sensu stricto, 5 (20.8%) were from immunocompetent subjects and 19 (79.2%) from immunocompromised patients (Figure 4).

Skin and nails: 35 isolates were analyzed, of which 100% were identified as C. parapsilosis sensu stricto, with 31 (88.6%) coming from immunocompetent patients (Figures 4 and 5).

Urine: Two isolates were retrieved from urine, and confirmed as C. parapsilosis sensu stricto, one of which was from an immunocompetent and the other from an inmmunocompromised subject (Figure 4).

Rectal mucosa: Only one isolate was retrieved from rectal mucosa. It was identified as C. parapsilosis sensu stricto. It came from an immunocompromised patient (Figure 4).

C. parapsilosis was found to have a higher probability of being retrieved from immunocompetent than immunocompromised patients, with statistically significant difference (Table 6).

Immunological status C. parapsilosissensu stricto N(%)
Competent 71 (74)
Compromised 25 (26)
Total 96 (100)

Table 6: Bivariate distribution of the parapsilosis complex according to host immunological status.

Antifungal susceptibility profile: Fifty of the 101 strains characterized as C. parapsilosis sensu stricto were selected to test for susceptibility to six antifungal agents which are regularly used in clinical practice: FLC, VRC, CASPO, MICA, AMB and FLUCY (Table 7). The selected strains came basically from the oral cavity and blood.

Drug  S N(%) IS N(%) DDS N(%) R N(%) WT N(%) noWT N(%)
FLC 42 (84) - 5(10) 3(6) 42 (84) 8 (16)
VRC 49 (98) 1(2) - - 49 (98) 1 (2)
CASPO 48 (96) - - 2(4) 48 (96) 2 (4)
MICA 50 (100) - - - 50 (100) 0
AMB ND ND ND ND 50 (100) 0
FLUCY ND ND ND ND 0 50 (100)

Table 7: Antifungal susceptibility profile of 50 strains of C. parapsilosis sensu stricto.

According to the species-specific cutoff point proposed by the CLSI Subcommittee in 2012, only 3 (6%) of the 50 strains showed a phenotype resistant to fluconazole, two of which were resistant to both FLC and CASPO. Five strains showed dose-dependent susceptibility to FLC (Table 7). It was not possible to classify the strains regarding amphotericin B because there is no validated clinical cutoff point. However, considering the epidemiological cutoff value (ECV) proposed for AMB and the species parapsilosis, 100% of the strains were wild-type phenotype (Figure 6). Since there is no validated CBP for flucytosine in this Candida species, the response of the 50 strains to it would be considered as undetermined (ND) (Table 7). However, considering the ECV, 100% of the strains were non wild-type to flucytosine, i.e. strains which have developed resistance mechanism to flucytosine (Figure 6).

emerging-infectious-diseases-antifungal-agents

Figure 6: The antifungal agents showing least activity against the strains assessed were FLUCY and FLC.
Note: The less active drugs against the strains tested were FLUCY and FLC. The best response to MICA and AMB was obtained

Table 11 shows the minimum inhibitory concentration (MIC) needed to inhibit 50 and 90% of the strains, and the MIC range for each drug tested. The highest frequency of resistance and/or reduced susceptibility to FLC was obtained. For AMB and FLUCY, resistance frequency in the 50 strains is undetermined (ND) because there is no validated species-specific cutoff point. However, according to the epidemiological cutoff point (Pfaller and Diekema 2012) [12], all 50 strains were wild type to AMB and no wild type to FLUCY (Figure 6).

Analysis of the distribution of strains with resistant phenotype as determined by ECV, according to the niche from which they were isolated, showed that the largest percentage came from skin and blood (Figure 7).

emerging-infectious-diseases-skin-blood

Figure 7: The distribution suggests that the probability of retrieving C. parapsilosis strains with resistant phenotype is greater from the skin and blood niches.

Discussion

Many studies around the world report that within the complex, C. parapsilosis sensu stricto is the species most frequently recovered from clinical isolates in both pathological and commensal conditions [1-6,13,14]. However, there are few studies reporting prevalence and distribution of the species in this complex under conditions of oral health and disease. So far, C. parapsilosis sensu stricto is known to be the most prevalent species in oral cavity niches in conditions of immunocompetence, regardless of geographical region, as reported by studies from USA [5], Portugal [1], Turkey [6] and China [2]. One study from Brazil investigated the distribution of the species in this complex within the oral cavity of patients with chronic immunodeficiency due to HIV, in whom C. metapsilosis was the most frequently isolated species, followed by C. parapsilosis sensu stricto, although the difference was not statistically significant and the sample was very small [15].

In our study, only C. parapsilosis sensu stricto was isolated, with 100% prevalence in all samples recruited from oral cavity and other human ecological niches, predominating under conditions of immunocompetence. This result is similar to those reported by other authors such as Lotfali et al. [16] and Odds et al. [17-25], but in contrast to the results of most papers on the subject, which report recovery of C. orthopsilosis and C. metapsilosis in both hemocultures and various clinical samples (Tables 9 and 10).

DRUG MIC
(ug/ml)
CBPs ECV
S DDS/IS R WT NoWT
FLC 4   x     X
VRC     x     X
CASPO     x     X

Table 8: Response profile to FLC, VRC and CASPO for a strain from tongue which showed reduced susceptibility

Ecological niche C. parapsilosis C. orthopsilosis C. metapsilosis Study country Reference
Various clinical samples 18 (90.0%) 0 2 (10%) Hungary [18]
Hemocultures 60 (95%) 1(2%) 2(3%) Italy [19]
Hemocultures 67 (85.9%) 5 (6.4%) 6 (7.7%) Spain [20]
Various clinical samples 111 (91.0%) 10 (8.2%) 1 (0.8%) Spain [21]
Invasive clinical samples 1762 (92.1%) 117 (6.1) 34 (1.8%) Global [3]
Hemocultures 29 (70.7%) 10 (24.4%) 2 (4.9%) Malaysia [22]
Various clinical samples 109 (95.6%) 5 (4.4%) 0 Kuwait [10]
Variasmuestrasclínicas 160 (94.6%) 4 (2.4%) 5 (2.9%) Portugal [1]
Hemocultures 126 (88.1%) 13 (9%) 4 (2.8%) Brazil [13]
Hemocultures 75 (95.0%) 2 (2.5%) 2 (2.5%) Denmark [23]
Invasive clinical samples 112 (53.3%) 30 (14.3%) 56 (26.7%) China [24]
Various clinical samples 81 (83.5%) 7 (7.2%) 9 (9.3%) Taiwan [25]
Various clinical samples 41 (71.9%) 0 16 (28.1%) Eastern China [2]
Various clinical samples 96 (100%) - - Argentina This study

Table 9: Distribution of species from the Candida parapsilosis complex, summarized from published papers

Author C. parapsilosis C. orthopsilosis C. metapsilosis Study country Reference
N (%) N (%) N(%)
Moris et al. 7 (46.7) 0 8 (53.3) Brazil (2014) [15]
Enger et al. 9 (64.3) 5 (35.7) 0 Global (2001) [32]
Silva et al. 65 (94.2) - 4 (5.8) Portugal (2009) [1]
This study 34 (100) 0 0 Argentina [33]

Table 10: Distribution of C. parapsilosis complex species in oral cavity niches, summarized from published studies.

Our study found that the probability of recovering C. parapsilosis sensu stricto from oral cavity is higher under pathological conditions, in agreement with a Chilean study published in 2008 [26], which reports a lower prevalence of yeasts, as reflected by a lower count of colonyforming units (CFU/ml) of Candida species, among periodontally healthy subjects than among periodontally affected subjects, with statistically significant difference. We also found that C. parapsilosis is more often recovered in presence of prosthetic or orthodontic devices. This is consistent with Jewtuchowicz et al. [27] who found higher prevalence of Candida genus yeasts from subgingival niches in immunocompetent non-smokers with periodontal condition who wore prosthetic devices than in non-users, identifying both albicans and non-albicans species, and recovering C. parapsilosis in the latter group. Our study also found that colonization by C. parapsilosis sensu stricto is more common in oral mucosa than in gingival sulcus. This is in agreement with Urzúa et al. [26], who showed that it is more common to recover Candida parapsilosis from oral mucosa sites than from subgingival niches, in conditions of both health and disease; with C. albicans y C. dubliniensis being more frequently isolated from the subgingival niche [26]. It should be highlighted that there is no published paper specifically studying the parapsilosis complex in relation to the three variables analyzed. However, a review of PubMed (http://www.ncbi.nlm.nih.gov/pubmed/) did show that to date, recovery of C. parapsilosis and other non-Candida albicans species such as C. tropicalis, C. dubliniensis and C. glabrata is greater in subjects with periodontal disease [26,28], poorly controlled diabetics [29]; female subjects who use oral contraceptives [30]; and male subjects who use androgenic steroids [31,32]. Based on our review of this database, we can say that ours is the first study in Argentina and the American continent to study the distribution and behavior of this complex in the oral cavity based on a collection of more than 20 isolates (Table 10).

Seventy-four percent of the strains came from immunocompetent subjects. This result is consistent with Constante et al. [33], who report that C. orthopsilosis is able to produce disease mainly in immunodepressed patients. C. parapsilosis may thus be the most pathogenic species in the complex, since it has shown that it is able to produce disease especially in conditions of immunocompetence.

Resistance or tolerance to antifungal agents in species in the parapsilosis complex is a growing problem in the context of usual and new antifungal agents. According to some studies, C. parapsilosis sensu stricto isolates are less susceptible than C. orthopsilosis and C. methapsilosis isolates to some antifungal agents used in the treatment of candidiasis, such as amphotericin (AMB), fluconazole (FLC), itraconazole (ITC) and caspofungin (CASPO). Among the azolederived agents analyzed in our study, FLC was the least active, with 8 C. parapsilosis sensu stricto strains showing resistance and/or reduced susceptibility to it. In agreement with this, Silva et al. [9] found an MIC for FLC equal to 16ug/mL for a C. parapsilosis sensu stricto isolate, and similar results have been reported by Gomez-Lopez et al. [34] In contrast, Ataides et al. [13] and Ruiz et al. [35] report resistance in a C. parapsilosis sensu stricto isolate to ITC but not to FLC. In this regard, Van Asbeck et al. [14] suggest that the differences in susceptibility to FLC may also reflect different affinities for azoles in the key enzyme that synthesizes ergosterol, 14-α-demethylase or for other enzymes in this pathway. Interestingly, MIC50 and MIC90 for both azoles (Table 11) found for the 50 study strains are comparatively higher than values reported for other regions such as Turkey [6], Spain [4], and Argentina [36]. This demonstrates geographic variability regarding the way in which species in this complex respond to antifungal drugs.

DRUG MIC50 (µg/ml) MIC90 (µg/ml) MIC RANGE (µg/ml) RESISTANCE FREQUENCY
FLUCO <=1 4 <=1-64 16%
VORICO <=0.12 <=0.12 <=0.12-<=0.25 2%
CASPO 0.5 1 0.5->=4 4%
MICA 0.5 1 0.5-1 0%
ANFO B <=0.25 0.5 0.25-0.5 ND
FLUCY <=1 <=1 <=1 ND

Table 11: MIC50 and MIC90 values for each drug tested for the 50 study strains.

Two isolates were resistant to CASPO in our study. This is consistent with the worldwide trend, since many papers have reported that the MIC for CASPO in C. parapsilosis sensu stricto is higher than that for the other two species in the complex. Mutations in the FKS gene have been found to be associated with resistance to CASPO, as shown by the increase in MIC in mutant isolates compared to non-mutant or wildtypes [37,38]. In contrast to the results with CASPO; all 50 strains were sensitive to MICA, and the MIC50 and MIC90 for both echinocandins was comparatively lower than reported in other parts of the world such as Turkey [39,10], Spain [8]. But this response was similar to that reported by Lockhart [3] and Canton [40].

Based on ECV, all strains were susceptible to AMB, in agreement with other studies [16,18]. However, Ataides et al. [13] and Lockhart et al. [3], reported resistance of the species C. parapsilosis sensu stricto to AMB. The response of the parapsilosis complex species to AMB varies considerably among regions, which may be determined by intra-species genotype variability.

In our study, 100% of the isolates presented MIC values lower than or equal to 1ug/mL FLUCY. As with AMB, there is no consensus on the cutoff point for FLUCY for the species Candida parapsilosis. Nevertheless, considering the ECV classification proposed by Pfaller and Diekema in 2012 [12], we found that 100% of the strains were resistant to FLUCY, since according to ECV, an MIC value for FLUCY equal to or less than 0.5 μg/ml corresponds to a wild-type (WT) strain, while an MIC value greater than 0.5 μg/ml indicates a Non-WT strain which has developed resistance mechanisms. However, the British Society for Mycopathology [39] establishes as flucytosine-“sensitive” isolates those which have an MIC to flucytosine equal to or less than 1 μg/ml. Our study found an MIC value for flucytosine for the 50 strains which is higher than those reported by Silva et al. [1], Miranda et al. [4] and Cantón et al. [40] in Europe. But in India, Bhatt et al. [41] found a high resistance rate to flucytosine in C. parapsilosis isolates.

Due to the fact that we did not recover C. orthopsilosis or C. metapsilosis, we were unable to establish differences in the response profiles among the 3 species in this complex.

Conclusions

-- In Argentina, C. parapsilosis sensu stricto may be the most prevalent species in the complex in different human ecological niches, under conditions of both health and disease, being more likely to be retrieved in situations of immunocompetence.

-- C. parapsilosis sensu stricto is a common species in oral mucosa, predominating in pathological conditions and in presence of prosthetic devices.

-- In the Argentine population, C. orthopsilosis and C. metapsilosis are probably two uncommon species in different human ecological niches, under both pathological and commensal conditions.

-- Subgingival sites in the oral cavity may constitute an unfavorable microenvironment for colonization and development by C. parapsilosis.

-- The response of C. parapsilosis sensu stricto to antifungal agents seems to depend on the strain and the geographic region.

-- Mouth and skin may be reservoirs for C. parapsilsois strains with resistant phenotype and/or reduced susceptibility to the group of azoles, echinocandins and flucytosine.

Recommendations

Depending on the limitations of this study, we suggest:

- Repeating this study design but in a prospective model and with a larger sample size to minimize the random error inherent to the process.

- Validate the results of in vitro antifungal sensitivity with the reference method (CLSI M27-S4 / 2008)

- Evaluate sensitivity and specificity of the molecular technique employed in this study to discriminate at species level, by comparing it to the Gold standard in a large number of samples.

- Study the impact of the oral microenvironment in dysbiosis on the virulence of Candida parapsilosis sensu stricto.

References

--
Post your comment

Share This Article

Article Usage

  • Total views: 3602
  • [From(publication date):
    December-2016 - Apr 16, 2025]
  • Breakdown by view type
  • HTML page views : 2719
  • PDF downloads : 883
Top