Research Article |
Open Access |
|
|
Molecular Characterization of Novel form of Type III Polyketide Synthase from
Zingiber Officinale Rosc. and its Analysis using Bioinformatics Method |
Radhakrishnan.E.K 1, K.C. Sivakumar 2, E.V. Soniya 1* |
1Plant Molecular Biology Lab, Rajiv Gandhi Centre for
Biotechnology, Poojappura, Thiruvananthapuram- 695014, India |
2Bioinformatics Facility, Rajiv Gandhi Centre for
Biotechnology, Thiruvananthapuram, Kerala, India |
| *Corresponding author: |
Dr. E.V. Soniya, Plant Molecular Biology Lab,
Rajiv Gandhi Centre for Biotechnology, Poojappura,
Thiruvananthapuram-695014,
India,
Tel : 91-471-2529454,
Fax : 91-471-2348096
E-mail : evsoniya@rgcb.res.in |
|
| Received May 25, 2009; Accepted July 16, 2009; Published July 17, 2009 |
|
Citation: Radhakrishnan EK, Sivakumar KC, Soniya EV (2009) Molecular Characterization of Novel form of Type III Polyketide Synthase from Zingiber Officinale Rosc. and its Analysis using Bioinformatics Method. J Proteomics Bioinform
2: 310-315. doi:10.4172/jpb.1000090 |
| |
Copyright: © 2009 Radhakrishnan EK, et al. This is an open-access article distributed under the terms of the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author
and source are credited. |
| |
|
Enzymes of Type III polyketide synthase superfamily play an important role in the biosynthesis of medicinal
natural products in plants. The PKSs generate the diversity of polyketide derivatives by changing their preference
for starter molecules, the number of acetyl additions catalysed and the cyclisation of the polyketide intermediates.
The amazing structural features of gingerol and related compounds of ginger (Zingiber officinale Rosc.,
Zingiberaceae) provide a genomic insight in to the presence of novel forms of PKS. The current study describes
the isolation and characterisation of a novel of PKS from Z. officinale using degenerate oligonucleotide based
PCR method. The inducible expression of recombinant ZoPKS in E. coli resulted in the formation of a protein
with approximate molecular weight of 43kD. The comparative sequence and phylogenetic analysis of ZoPKS
shows its significant variation from already identified PKSs. The novelty of the ZoPKS was further confirmed by
homology modeling based comparative structural bioinformatics analysis. The novel form of PKS identified in
the study has very remarkable amino acid substitutions at the key residues determining the starter substrate
selectivity and condensation reactions and forms a genomic basis of PKS from Z. officinale to explore its potential
in biosynthesis of gingerol and related compounds. |
Introduction |
The amazing diversity of polyketide derivatives in plants
is generated by a group of structurally related enzymes
called as the type III polyketide synthases (PKSs). The most
well known and widely distributed member of the PKS superfamily
is the chalcone synthase(Winkel-Shirley, 2001).
In the typical reaction mechanism, it forms the chalcone by
the stepwise decarboxylative condensation of coumaroyl
CoA with three malonyl coA followed by the claisen type
cyclisation of the tetraketide product (Jez et al., 2001). Extensive
gene duplication followed by the functional divergence
is believed to have played an important role in generating
the biochemical diversity of PKS superfamily. The expanding members of the family, as shown by the identification
of 2-pyrone synthase, stilbene synthase, benzalacetone
synthase, valerophenone synthase, acridon synthase etc.,
from various sources indicate that the biosynthetic potential
of the PKS is just begin to be explored and many more
members are to be identified from plants especially from
medicinal plants (Austin and Noel, 2003). |
Zingiber officinale Rosc. (ginger, Zingiberaceae) is well
known for its use in traditional therapeutic and preventive
medicine. The major pharmacologically active component
present in Z. officinale is of the gingerol group (Ramirez-
Ahumada Mdel et al., 2006). Molecular insight in to the
gingerol biosynthesis suggested that enzymes similar to type III polyketide synthases are having important role (Denniff
et al., 1980; Schröder, 1997). Considering the pharmacological
potential of gingerol and the distribution of structurally
similar compounds in other members of the family, identification
and characterisation of the PKS from Z. officinale
can provide a genomic basis for elucidation of biosynthetic
pathway. In the present work, we are reporting the cloning
and characterisation of a novel form of type III PKS fromZ. officinale. The comparative structural bioinformatic
analysis suggests that the PKS identified in the study may
be a prime candidate for the biosynthesis of phenylbutanone
derivatives of Z. officinale. |
Materials and Methods |
Zingiber officinale var. Rio de Janeiro was used as the
experimental material for the study. The plants were
collected from Kerala Agricultural University,
Thiruvananthapuram, Kerala and were grown and
maintained in the experimental plant garden at Rajiv Gandhi
Centre for Biotechnology, Thiruvananthapuram, Kerala. |
PCR and Cloning |
| Total RNA was isolated from young leaves of Z. officinale
by Trizol method and reverse transcribed using the MMLV
RT (Promega). Amplification of core cDNA fragment of
PKS was carried out by nested RT-PCR using the inosine
containing degenerate oligonucleotide primers as reported
earlier (Abe et al., 2001). The sequences of the primers are
as follows: PKS1 5’-RARGCIITIMARGARTGGGGICA-
3’, PKS2 5’-GCIAARGAYITIGCIGARAAYAA-3’, PKS3
5’-CCCMWITCIARICCITCICCIGTIGT-3’ and PKS4 5’-
TCIAYIGTIARICCIGGICCRAA-3’. The primers PKS1,
2, 3 and 4 represents the 112, 174, 368 and 380 amino acid
position of typical CHS. The conserved amino acid residues
at these areas provide opportunities for nested PCR
based approach for isolating core sequence of PKSs from
taxonomically diverse plants. The introduction of degenerate
bases and inosine makes the primers to bind to functionally
divergent members of PKS family. The core fragment
(major part of the second exon) of PKS contain most of the
residues contributing to the catalytic architecture. So the
changes observed on conserved residues at these areas may
have remarkable impact on reaction mechanism of PKS.
The primary PCR reaction (50 μl) contained the cDNA template,
30 pmoles of each primers (PKS1 and PKS2), 1.25
units of Taq DNA polymerase (Promega), 1.5 mM MgCl2
and 200 μM of each dNTPs. The reaction was carried out
for 35 cycles in a Bio-Rad iCycler using the following conditions;
initial denaturation was done for 3 min at 94°C, the
cyclic denaturation at 94°C for 30 sec, annealing at 42°C
for 1 min and extension at 72°C for 1 min with a final extension at 72°C for 7 min. The secondary PCR was carried
out using primer sets of PKS3 and PKS4 using 1 μl of
the primary PCR product as template under the same PCR
conditions as for the primary PCR. The PCR product was
analysed in a 2% agarose gel and was purified using the
GFX gel band purification system (Amersham). The purified
fragment was ligated to pGEMT easy vector (Promega)
and propagated in Escherichia strain JM109 (Promega).
Plasmid isolation and purification was done using the Wizard
Plus SV Minipreps DNA purification system (Promega).
Automated sequencing of recombinant clones was carried
out using Big Dye™ Terminator Cycle Sequencing Ready
Reaction Kit Version.3.1 (Applied Biosystem) in the ABI
3730 DNA sequencer. |
3’ and 5’ RACE |
| Gene specific primers designed from the core fragment
of PKS from Z. officinale were used for the RACE
experiments. The RACE ready cDNA was prepared using
the First Choice RLM RACE kit (Ambion). The primers
used for the 3’ RACE were PKS31 5’-
ATCGCCAAGGACCTGGCGGAGA -3’ and PKS32 5’-
ACAACCGCGGCGCGCGCGTCCTCG -3'. The primers
used for the 5’ RACE experiments were PKS51 5'-
GATGTTGCTCGCAATGATCGACGGAA-3' and PKS52
5'- ATGATCGACGGAAGCTGGCTCTTGAGG- 3'. For the
3’ RACE, the primary PCR was carried out with the primer
set of PKS31 and 3’ RACE outer primer and the secondary
PCR with PKS32 and 3’ RACE inner primer. The PCR
condition used were; initial denaturation at 94 oC for 3 min,
cyclic denaturation at 94°C for 30 sec, annealing at 65°C
for 30 sec and extension at 72°C for 1 min with a final
extension of 7 min at 72°C. The product formed in the
secondary PCR was cloned and sequenced. The 5’ RACE
ready cDNA was used as template for the 5’ RACE PCR
using the primers PKS51 and PKS52. The primary PCR
was carried out using PKS51 and 5’ RACE outer primer
followed by the secondary PCR using the primer sets PKS52
and 5’ RACE inner primer. The conditions for both the PCR
experiments were; initial denaturation at 94°C for 3 min,
cyclic denaturation at 94°C for 30 sec, annealing at 65°C
for 30 sec and extension at 72oC for 1 min with a final
extension of 7 min at 72°C. The PCR product formed was
cloned and sequenced. |
Cloning and Expression of Full-length cDNA |
Full-length cDNA of PKS from Z. officinale (ZoPKS)
was isolated by RT-PCR using N-terminal gene specific
primer NPKSF 5' CGCTCGAGCATATGCATCA
CCATCACCATCACATGGGTAGCCTGCAGGCGATG 3'
containing the site for Nde I and six histidine residues and the C-terminal gene specific primer CPKSR 5'
CGGGATCCCTACGGTATTGGTAGACTGCGTAG 3'
containing the site for Bam HI . The PCR was carried out
with an initial denaturation for 3 min at 94°C, cyclic
denaturation at 94°C for 30 sec, annealing at 65°C for 30
sec and extension at 72°C for 2 min with a final extension
of 7 min at 72°C. The PCR product formed was cloned,
sequenced and analysed by BLAST programme. The
sequence was submitted to NCBI under the accession
number DQ486012. The phylogenetic analysis of ZoPKS
was carried out along with other PKSs by NJ and MP
methods implemented in the MEGA3 (Kumar et al., 2004). |
For the prokaryotic expression, the ZoPKS was cloned at
the BamHI/NdeI site of pET-32b (Novagen). The
recombinant clones were confirmed for the sequence and
transformed in to E. coli BL21(DE3)pLysS. The cells with
the recombinant plasmid were cultured to an OD600 of 0.6
in Luria-Bertani medium containing 100 mg/ml of ampicillin
at 28°C. The expression of the recombinant protein was
induced by the addition of 0.5 mM isopropyl thio-β-dgalactoside
by incubating at 28°C for 16 h. Western blotting
of the recombinant ZoPKS was carried out using antibodies
specific to His-tag (Sigma) (Towbin et al., 1979). |
Multiple Sequence Alignment and Homology
Modeling |
| Sequences of 14 plant PKSs were collected from the
NCBI database and was used along with ZoPKS for the
comparative structural analysis. Most of the selected PKSs
were biochemically studied and were shown to have role in
biosynthesis of plant specific metabolites. The sequences
selected were Ruta graveolens - Acridone synthase
(S60241), Aloe arborescens - Octaketide synthase
(AAT48709), Aloe arborescens - Pentaketide chromone
synthase (AAX35541), Arabidopsis thaliana - Chalcone
synthase (CAI30411), Gerbera hybriba - 2-pyrone
synthase (CAA86219), Humulus lupulus - Valerophenone
synthathase (BAB12102), Hydrangea macrophylla -
Coumaroyl triacetic acid synthase (BAA32733), Iris
germanica – Chalcone synthase (BAE53636), Oryza
sativa - Chalcone synthase (CAA61955), Rheum
palmatum - Benzalacetone synthase (AAK82824), Vitis
vinifera - Stilbene synthase (ABJ97068), Wachendorfia
thrysiflora - Polyketide synthase (AAW50921),Medicago sativa - Chalcone synthase (P30074) and Dendrobium nobile - Chalcone synthase (ABE77392).
The multiple sequence alignment of the sequences was done
by using the Clustal W programme (Thompson et al., 1994). |
Homology model of ZoPKS was generated based on the
crystal structure of CHS from M. sativa (PDB id – Ibi5) and 2-PS from G. hybrida (PDB id –1qlv) and were taken
as the representatives of the typical chalcone forming and
nonchalcone (Pyrone) forming members of the PKS super
family. X-ray crystallographic information of both the
templates was collected from the Protein Data Bank
(Berman et al., 2000). The alignment between the sequence
of ZoPKS and the structure of selected templates was
carried out using Clustal W as the starting point for modeling
the tertiary structure of ZoPKS. |
The HOMOLOGY and DISCOVER module (Insight II
User Guide 1997, MSI San Diego, CA) of the Insight II
molecular modeling package were used in the construction
and optimisation of structures of ZoPKS and other selected
PKSs. The computed models were verified for
stereochemical quality by using PROCHECK at RCSB web
site (http://rcsb-deposit.rutgers.edu). The graphical images
of the models were viewed and generated by using Pymol
graphical interface (http://pymol.sourceforge.net). The
structural impact of amino acid substitution on the shape
and size of substrate binding cavity of ZoPKS was
investigated on a comparative basis. The amino acid residues
forming the substrate binding region were mapped on all
the models generated and the images were generated using
the Pymol. |
Results and Discussion |
Gingerols, the major active components of ginger (Z.
officinale), has received a great deal of attention because
of its broad spectrum of biological activities including the
anti-inflammatory, anticarcinogenic, and antitumor activities.
Some initial investigations on gingerol biosynthesis identified
the potential of enzymes of the PKS family as designers of
its basic structural skeleton, but the lack of genomic
information of PKS is a limiting factor to unravel the complex
biosynthetic process. Degenerate oligo nucleotide primers
targeting the conserved region of PKS was used for isolating
the 600 bp core fragment of PKS by RT-PCR. This gene
specific sequence was used for designing primers for the
RACE experiments. The full length cDNA of PKS from Z.
officinale (ZoPKS) was found to have 1173 bp length and
was predicted to form a polypeptide of 43 kD containing
391 amino acid residues [Figure 1]. The BLAST analysis
of ZoPKS gave a maximum identity of 64% to the PKS
identified from W. thrysifolia. The low identity can be taken
as an indication of its novel functions since the members
exhibiting typical chalcone forming reactions are shown to
have more than 85% identity(Brand et al., 2006). |
The phylogenetic analysis of PKS superfamily showed
clustering based on their biochemical functions [Figure 2].
The ZoPKS was found to cluster distinctly with the nonchalcone forming PKSs like the benzalacetone synthase
from Rheum palmatum(Abe et al., 2001) , 2-pyrone synthase
(2PS) from Gerbera hybrida (Eckermann et al., 1998), 4-
coumaroyltriacetic acid lactone synthase (CTAS) from
Hydrangea macrophylla (Akiyama et al., 1999),
valerophenone synthase (VS) from Humulus lupulus
(Paniego et al., 1999) and acridone synthase (ACS) fromRuta gravenolens (Springob et al. , 2000). The
nonchalcone forming PKSs are involved in the biosynthetic
processes other than typical tetraketide derivatives and
because of their specific role, they are considered as speciesspecific
or metabolite speficic. Thus the characteristic
clustering of ZoPKS may support for considering its role in
nonchalcone forming reactions and possibility in the
biosynthesis of pehnylbutanone derivatives of Z. officinale.
The ZoPKS was cloned at the NdeI and BamHI site of
pET32b for studying its expressivity in the prokaryotic
system. The SDS-PAGE analysis showed the formation of
recombinant protein of approximately 43 kD up on IPTG
induction and was confirmed by the western blotting using
the anti-His antibody [Figure 3]. |
Multiple sequence alignment of ZoPKS with the other
PKSs showed that the conserved residues are located almost
same position in all [Figure 4]. The sequence identity analysis
of ZoPKS with the PKSs selected for the comparative
analysis shows that it is identical to other PKSs selected for
the analysis at a range of 49-64%. The maximum identity is
towards the PKS from W. thrysifolia (64%) and the
minimum is towards the A. arborescens pentaketide
chromane synthase (49%). The multiple alignment analysis
also revealed that the ZoPKS shows significant variations
of catalytic residues at the highly conserved pockets. The
catalytic triad forming the active site of the typical CHS like
Cys 164, His 303 and Asn 336 are maintained as such in
ZoPKS showing that it belongs to the PKS superfamily.
The ZoPKS also showed the presence of stretches of
conserved residues G(368)VL FGFGPGLT(378) considered
as the signature sequence of PKS superfamily [Figure 1]. |
Structural insight into the catalytic machinery of polyketide
biosynthesis was explained by the crystal structure studies
of CHS from Medicago sativa (Ferrer et al., 1999). The
studies showed that in addition to the catalytic triads, stringent
conservation of amino acid residues constituting the
catalytic pockets is also essential for the typical chalcone
forming reactions. These include the substrate binding
pocket (Ser133, Glu192, Thr194, Thr197 and Ser338) which
forms a 16Å tunnel to the active site cavity and the
cyclisation pocket (Thr132, Met137, Phe215, Ile254, Gly256,
Phe265 and Pro375). The overall architecture is maintained
by the conserved amino acid residues like the Pro138, Gly163, Gly167, Leu214, Asp217, Gly262, Pro304, Gly305,
Gly306, Gly335, Gly374, Pro375 and Gly376. A change in
the amino acid residues at these pockets was found to have
remarkable impact on the reaction mechanism leading to
metabolic diversity (Abe et al., 2001). The ZoPKS showed
significant amino acid substitution at these positions which
makes it to be analysed in detail to unravel the effect of
these changes. |
Among the amino acid residues constituting the substrate
binding pocket, ZoPKS showed variation from typical CHS
by the substitution of Thr (197) to Ser and Ser (338) to Gln.
Two amino acid substitutions are observed at the amino
residues forming the cyclisation pocket by replacing Thr
(132) with Ileu and Ileu (254) with Val. Furthermore, three
amino acid residues are replaced at the strongly conserved
residues shaping the geometry of the active site by changing
Gly (306) to Asn, Leu (214) to Gly, and Gly (163) to Ala.
The similar amino acid substitutions were observed in other
members of the nonchalcone forming PKSs and these
changes can be considered to have determining effect on
the functionality of PKS. The amino acid substitution of
S(338)I and T(197)L as observed in 2-Pyrone synthase
when compared to the CHS was found to reduce the size
of active site cavity to accept smaller substrates (Jez et al.,
2000). Very interestingly, site directed mutagenesis studies
revealed that substitution of just three amino acid residues
(T197L / G256L / S338I) can make the CHS to have 2-PS
activity showing the potential of key catalytic residues to
regulate the reaction mechanism (Jez et al., 2002). Similarly,
the PKS from W. thrysifola showed the replacement of
T197 and Ser 338 with more bulky Met and Phe. This also
have the characteristic Thr 132 to Gly substitution to provide
the additional rotational freedom resulting in the size reducing
effect (Brand et al., 2006). The active site analysis of
Aleosine synthase showed a downward expanding T197A
replacement, when compared to the typical CHS, illustrating
the significance of Thr 197 as the controller of the polyketide
chain length (Abe et al., 2006). Thus it is very probable that
the amino acid substitutions observed in ZoPKS can alter
the size and shape of cavity to favour the production of
compounds other than the tetraketides. The structural impact
of these substitutions on substrate binding pocket of ZoPKS
was analysed in detail on a comparative basis. |
Homology model of ZoPKS was generated based on the
crystal structure of CHS (M. sativa) and 2-PS (G. hybrida)
as templates. The energy minimisation of the modeled
structure was carried out in the DISCOVER using the
steepest descents algorithm (200 cycles) and conjugate
gradient (1000 cycles) until a low energy derivative of around
1 kcal.mole-1 had been reached. At this point the calculated total energy of the molecule was consistent with the relaxed
and stable conformation. The superposition of the ZoPKS
model structure with the template structures showed very
small deviation with an RMSD less than 0.5 Å and 0.8 Å
respectively respectively towards the 2-PS and CHS [Figure
5]. Similarly the homology models were also generated for
PKSs selected for the comparative structural analysis. The
quality of all the models was assessed by Ramachandran
plot analysis using PROCHECK. It helps to check the
stereochemical quality of the optimized structures. By the
inspection of phi/psi angle, we can analyse the quality of the
Ramachandran plot and can determine whether the protein
conformation belongs to the allowed region or not. The
Ramachandran plot analysis of the ZoPKS showed that
92.9% of the amino acid residues come under the most
favorable region, 6.2% amino acid residues come under the
additional allowed region and 0.6% amino acid residues come
under the generously allowed region. The same anaysis for
the crystal structure of CHS (M. sativa) and 2-PS (G.
hybrida) gave the result of 93.4% and 92.6% amino acid
residues at the most favorable region which strongly support
the stereochemical quality of the model. The Ramachandran
plot analysis of other PKSs selected for the study also
showed the distribution of 91-93% of amino acid residues in
the most favourable region [Table 1]. |
Although the PKSs have promiscuous substrate
specificity, the amino acid residues constituting the substrate
binding region was found to have mechanistic and steric
effects on the substrate selectivity (Brand et al., 2006). This
is also supported by the results of the multiple sequence
alignment in which the conserved residues forming the
substrate binding region were maintained as such in the CHSs
from Arabidopsis thaliana, Iris germanica, Oryza sativa
and Dendrobium nobile. But characteristically the amino
acid residues were substituted in other PKSs specifically
for their specific functions. So these residues were selected
for the comparative structural analysis of ZoPKS for making
predictions about its novel functions possibly as a
nonchalcone forming PKSs. The RMSD values of the Cα
atoms of all the amino acid residues forming the substrate
binding pocket like the Ser 133, Glu 192, Thr 194, Thr 197and
Ser 338 were calculated for the homology models by overlay
of the Cα atoms of generated models with the CHS of M.
sativa. A number of substantial differences were observed
for the RSMD values of ZoPKS and these differences along
with the changes in the positioning of the side chain indicate
the distinct structural characters of ZoPKS [Table2]. Very
interestingly the amino acid residues at the 338 position of
ZoPKS showed an RMSD value of 1.76 ? where the Ser is
substituted by more bulky Glu. The Ser at the 338 position was found to have role in starter substrate selectivity and is
more prone to substitution in members of nonchalcone
forming PKSs for the specific function (Abe et al., 2006).
In order to understand the combined effect of amino acid
substitutions at these well studied positions, the substrate
binding residues were mapped on modelled structures of
ZoPKS and other PKSs selected for the comparative
analysis. A significant variation is observed at the substrate
binding region of PKSs and the changes observed in ZoPKS
supports its novel functions [Figure 6]. The proposed reaction
mechanism for the gingerol biosynthesis demands the PKS
to have altered substrate selectivity, altered condensation
and cyclisation reactions when compared to the typical
CHSs. So the amino acid substitutions observed for the
ZoPKS may contribute the changes in the structural
architecture of ZoPKS to perform this novel function. But
it has to be demonstrated by in vitro studies to confirm and
the current study forms a genomic basis for this. As the
molecular fascination of PKSs is just begin to explore, the
remarkable changes observed on the PKS identified in the
study show that it forms a potential member of PKS
superfamily. |
References |
- Abe I, Takahashi Y, Morita H, Noguchi H (2001)
Benzalacetone synthase. A novel polyketide synthase that
plays a crucial role in the biosynthesis of phenylbutanones
in Rheum palmatum. Eur J Biochem 268: 3354-3359. » CrossRef » PubMed » Google Scholar
- Abe I, Watanabe T, Lou W, Noguchi H (2006) Active
site residues governing substrate selectivity and polyketide
chain length in aloesone synthase. FEBS J 273: 208-218. » CrossRef » PubMed » Google Scholar
- Akiyama T, Shibuya M, Liu HM, Ebizuka Y (1999) p-
Coumaroyltriacetic acid synthase, a new homologue of
chalcone synthase, from Hydrangea macrophylla var.
thunbergii. Eur J Biochem 263: 834-839. » CrossRef » PubMed » Google Scholar
- Austin MB, Noel JP (2003) The chalcone synthase superfamily
of type III polyketide synthases. Nat Prod Rep
20: 79-110. » CrossRef » PubMed » Google Scholar
- Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN,
(2000) The Protein Data Bank. Nucleic Acids Res
28: 235-242. » CrossRef » PubMed » Google Scholar
- Brand S, Holscher D, Schierhorn A, Svatos A, Schroder
J, (2006) A type III polyketide synthase fromWachendorfia thyrsiflora and its role in diarylheptanoid
and phenylphenalenone biosynthesis. Planta 224: 413-
428. » CrossRef » PubMed » Google Scholar
- Denniff P, Macloed I, Whiting DA (1980) Studies in the biosynthesis of [6]-gingerol, pungent principle of ginger
(Zingiber officinale). Journal of the Chemical Society
Perkin Transactions 1: 2637-2644. » CrossRef » Google Scholar
- Eckermann S, Schroeder G, Schmidt J, Strack D, Edrada
RA, (1998) New pathway to polyketides in plants.
Nature 396: 387-390. » CrossRef » Google Scholar
- Ferrer JL, Jez JM, Bowman ME, Dixon RA, Noel JP
(1999) Structure of chalcone synthase and the molecular
basis of plant polyketide biosynthesis. Nat Struct Biol
6: 775-784. » CrossRef » PubMed » Google Scholar
- Jez JM, Austin MB, Ferrer J, Bowman ME, Schroder J,
(2000) Structural control of polyketide formation in
plant-specific polyketide synthases. Chem Biol 7: 919-
930. » CrossRef » PubMed » Google Scholar
- Jez JM, Bowman ME, Noel JP (2001) Structure-guided
programming of polyketide chain-length determination
in chalcone synthase. Biochemistry 40: 14829-14838. » CrossRef » PubMed » Google Scholar
- Jez JM, Bowman ME, Noel JP (2002) Expanding the
biosynthetic repertoire of plant type III polyketide
synthases by altering starter molecule specificity. Proc
Natl Acad Sci USA 99: 5319-5324. » CrossRef » PubMed » Google Scholar
- Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated
software for Molecular Evolutionary Genetics Analysis
and sequence alignment. Brief Bioinform 5: 150-163. » CrossRef » PubMed » Google Scholar
- Paniego NB, Zuurbier KW, Fung SY, van der Heijden
R, Scheffer JJ, et al. (1999) Phlorisovalerophenone synthase, a novel polyketide synthase from hop (Humulus
lupulus L.) cones. Eur J Biochem 262: 612-616. » CrossRef » PubMed » Google Scholar
- Ramirez-Ahumada MC, Timmermann BN, Gang DR
(2006) Biosynthesis of curcuminoids and gingerols in
turmeric (Curcuma longa) and ginger (Zingiber
officinale): identification of curcuminoid synthase and
hydroxycinnamoyl-CoA thioesterases. Phytochemistry
67: 2017-2029. » CrossRef » PubMed » Google Scholar
- Schröder J (1997) A family of plant-specific polyketide
synthases: facts and predictions. Trends in Plant Science
2: 373-378. » CrossRef » Google Scholar
- Springob K, Lukacin R, Ernwein C, Groning I, Matern
U (2000) Specificities of functionally expressed chalcone
and acridone synthases from Ruta graveolens.
Eur J Biochem 267: 6552-6559. » CrossRef » PubMed » Google Scholar
- Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL
W: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, positionspecific
gap penalties and weight matrix choice. Nucleic
Acids Res 22: 4673-4680. » CrossRef » PubMed » Google Scholar
- Towbin H, Staehelin T, Gordon J (1979) Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose
sheets: procedure and some applications. Proc
Natl Acad Sci USA 76: 4350-4354. » CrossRef » PubMed » Google Scholar
- Winkel-Shirley B (2001) Flavonoid biosynthesis. A colorful
model for genetics, biochemistry, cell biology, and
biotechnology. Plant Physiol 126: 485-493. » CrossRef » PubMed » Google Scholar
|
|
| This Article |
| DOWNLOAD |
|
| CONTRIBUTE |
|
| SHARE |
|
| EXPLORE |
|
|
|
|