This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Using a new pEnLox vector employed to generate gain-of-function mutants in Arabidopsis thaliana, the AtFAS4 mutant has been obtained and analyzed. The mutant is characterized by super-expression of the At1g33390 gene, which leads to the occurrence of a mutant phenotype - stem fasciation. The level of expression of the AtFAS4 gene in normally developing A.thaliana plants is extremely low thus accounting for almost complete absence of information on EST's of this gene. The generated AtFAS4 mutant has permitted full-length cDNA of the At1g33390 gene to be obtained and analyzed for the first time.
Activation taggingArabidopsis thalianaFull length cDNAStem FasciationcitationGennady P, Oksana F, Eugene K (2008) IDentification and Analysis of the Arabidopsis Thaliana Atfas4 Gene Whose Overexpression Results in the Development of A Fasciated Stem.Introduction
Large collections of Arabidopsis thaliana transgenic plants are presently available with T-DNA or mobile elements used as insertions and can be found at the following locations; ABRC (http://www.arabidopsis.org/abrc/), NASC (http:// nasc.nott.aac.uk/), SALK (http://signal.salk.edu/) and GABI (http://www.gabi-kat.de/). Most of these collections, however, are based on insertions causing so-called loss-of-function mutations related to inactivation of genes carrying insertions (Feldmann, 1991). Other types of mutations, like mutations determined by super-expression of genes, are represented in the available collections rather poorly.
A system of two vectors, pEnLox (DQ645630) and pCre (DQ635631), has been previously constructed (Pogorelko et al., 2007). Vector pEnLox contains an enhancer (a tetramer of the cauliflower mosaic virus 35S RNA promoter) able to induce super-expression of genes adjacent to the site of insertion integration and directed to the start-codon, ith this direction corresponding to the direction of gene transcription.
Eight lines have been obtained with the use of the pEnLox vector carrying an insertion in such orientation that the enhancer in the T-DNA structure is directed to the start-codon of translation of a nearby gene (Pogorelko et al., 2008). Thus this arrangement is potentially able to cause superexpression of the nearby gene. Three of the mutant lines differ by phenotype from wild-type plants. A molecular-genetic analysis of the E78 line has been carried out and the mutant plants of this line have been designated as AtFAS4.
Materials And MethodsPlant Material And Growth
Arabidopsis thaliana plants of the Col-0 ecotype were grown at 21-23°C in normal-day conditions (16 h of light and 8 h of dark) under Phillips BioLux fluorescent lights.
RNA Purification and cDNA Synthesis
RNA isolated from the plants using a RNA purification kit (Plant RNA Isolation Reagent, http://www.invitrogen.com/) served as a template for synthesis of the first cDNA strand using an Invitrogen kit (5' RACE System for Rapid Amplification of cDNA Ends; 3' RACE System for Rapid Amplification of cDNA Ends; GeneRacer® Kit with AMV RT and TOPO TA Cloning® kit for Sequencing) (http://www.invitrogen.com).
Identification of full-length cDNA of the At1g33390 gene
Full-length cDNA was synthesized using a special kit from Evrogen (http://www.evrogen.ru/) strictly following the instructions. Since AtFAS4 cDNA is more than 4 kb in size, its amplification was carried out in 5 sequentially overlapping PCR fragments with the following primers:
Fragment 1 (5'end)
M1 (Evrogen)
At1g33390_Rev1 ACGACAAGTTGTCAGTGGGA
Fragment 2
At1g33390_Forw2 GCAACTGGTTCATGCTGATC
At1g33390_Rev2 GACTCTTTTGTTGTTCCTCG
Fragment 3
At1g33390_Forw3 CTTATTGAGGCGTTATCTTG
At1g33390_Rev3 ACAGTGACCAGGTCCAGTTC
Fragment 4
At1g33390_Forw4 ACTTCTCTGACTATTCCTGG
At1g33390_Rev4 GGAGCTGAGTTTATGAGAGA
Fragment 5 (3'-end)
At1g33390_Forw5 GTGTAGCCAGAAAGACCAGAG
M1 (Evrogen)
Bioinformatic tools
Promoter regions were identified using the PromoterInspector (http://www.genomatix.de/) and Promoter Prediction (http://www.fruitfly.org/seq_tools/ promoter.html) programs which allow to predict promoter egions and initial transcription sites. The MatInspector program with plant filter (http://www.genomatix.de/) was used for search of binding sites of transcription factors.
ResultsPhenotype And Genotype Of The Mutant
The morphological distinction of the E78 line is a clearly visible fasciated stem consisting of 7-12 stems (Figure 1). Segregation analysis showed the mutant trait to be inheritable in a monogenic fashion (3:1 segregation, 0.56 < 3.84 for p=0.05) (Table 1). Southern blot-hybridization demonstrated the presence of a single T-DNA insertion copy in the genome of E78 plants (Suppl. Figure 1). The modified inverse PCR method was used to identify the site of T-DNA insertion in the genome of E78 line plants (Pogorelko and Fursova, 2008). Sequencing and subsequent analysis in silico of the obtained DNA fragment allowed us to determine the place of T-DNA integration in the genome of E78 plants (GenBank Acc.: EI183464). The insertion is localized in the precentromeric region of chromosome 1. A more detailed analysis showed the insertion to precede the start-codon of the AtFAS4 gene (approximately at a distance of 0.5 kb) and the enhancer to be oriented to the start-codon. This enhancer acts at a distance of 380 bp-3.6 kb from the target gene (Weigel et al., 2000).
Analysis of AtFAS4 expression
Since the mutant phenotype of E78 plants is determined by the activity of the enhancer contained in T-DNA, we analyzed AtFAS4 gene expression in 4 independent E78 mutant sub lines (T1 generation plants that had been selected by "Basta") and in wild-type plants (Figure 2).
The AtFAS4 gene was found to be expressed in the mutant plants and not expressed in the wild-type plants. Analysis of the databases containing information on ESTs demonstrated the availability of only two experimentally obtained partial cDNAs from the 3'-region of At1g33390 mRNA (GenBank Acc.: AU235278 and AU225941) (http:// rarge.gsc.riken.jp/). mRNA of the At1g33390 gene represented in the databases was obtained by the methods of computer analysis of the genome (NM_103064).
Comparison of the phenotypes of plants E78 and A.thaliana Col0. Age - 7 weeks. (A) AtFAS4 mutant, (B) Wild-type A.thaliana Col-0 mutant
Analysis of the Genevestigator database (https:// www.genevestigator.eyhz.ch/) containing information on the expression of genes in different organisms with the use of the Microarray technology provided information on the expression of the AtFAS4 gene (Figure 3) using mRNA extracted from the A.thaliana plants grown under normal conditions.
According to these data, the AtFAS4 gene has a very low expression as compared to the constitutively expressed "house-keeping" At3g18780 gene whose level of transcription is characteristic of genes controlled by the CaMV35S promoter.
Thus, the analysis of information from different databases confirmed our experimental results.
Analysis of AtFAS4 gene structure
We obtained and analyzed full-length cDNA of the AtFAS4 gene from a mutant plant (EF630362). As a result, the gene was found to have 8 exons, which is in agreement with the predicted gene model (NM_103064). However the synthesis of AtFAS4 mRNA in a mutant plant of the E78 line starts from the promoter of the vector and as a consequence the point of initiation of AtFAS4 gene transcription remains unknown. We used "PromoterInspector" and "Promoter predictions" programs to determine in silico the site of transcription initiation and 5'-UTR.
Therefore our results permit elaboration of the primary structure of the AtFAS4 gene that was previously predicted in silico (NM_103064). The promoter predicted with the Promoter predictions program corresponds to the promoter predicted on a Genomatix server. However the transcription start point predicted with the Promoter predictions program is at a distance of 15 bp after the start of translation in the gene model (NM_103064). The start of translation determined by us is in position 26 from the start of transcription predicted by the programs. Further analysis of the amino acid sequence permits our variant of the 5'-region structure to be considered as more correct.
An electrophoregram of RT-PCR products of an AtFAS4 fragment (A) and control Actin-2 fragment (B). The overall pools of RNA isolated from 4 independent mutant plants and Col-0 wild type Arabidopsis plant were used as a template for synthesis of the first cDNA strand using an Invitrogen kit (www.invitrogen.com). The RT products were used as a template for PCR with primers At1g33390_ Forw2 (GCAACTGGTTCATGCTGATC), At1g33390_Rev2 (GACTCTTTTGTTGTTCCTCG). The actin-2 house-keeping gene was used to normalize the amount of RNA and to control RNA quality. For the Actin-2 amplifying two primers, Actin-2For (CTCTCCCGCTATGTATGTCGC) and Actin-2Rev (GAAACCCTCGTAGATTGGCA) were used. (A) M. 1kb+ Invitrogen DNA marker 1. E78/1-mutant plant 2. E78/2-mutant plant 3. E78/3-mutant plant 4. E78/4-mutant plant C. Wild-type A.thaliana Col0 (B) 1. E78/1-mutant plant 2. E78/2-mutant plant 3. E78/3-mutant plant 4. E78/4-mutant plant C. Wild-type A.thaliana Col0 M. 1kb+ Invitrogen DNA marker
Comparison of expression of the genes At3g18780 (Housekeeping gene, transcriptional factor with constitutive expression) (left) and AtFAS4 (right) in wild-type plants.
Analysis of the promoter, using MatInspector program, revealed the presence of 12 sites of binding of transcriptional factors (TF) on the positive chain. These transcriptional factors belong to 5 TF families characteristic of plants (Table 2, Figure 4). The optional parameters used for TF searching are presented in Table 2.
Promoter region of the AtFAS4 gene with recognition sites of the transcription factors.
In silico analysis of the At1g33390 amino acid sequence
Comparison of the AtFAS4 amino acid sequence with the known or predicted proteins showed the presence of two domains and fragments of two more domains. The omain of DEXH-box or DEAD-box helicases is located at the Nend of the protein. It participates in ATP-dependent denaturation of DNA or RNA. The C-end of the protein contains the DUF1605 domain. Its function is unknown but it is always found at the C-end of DEAD-box helicases. A fragment of the HrpA domain (the central part of the protein) is found in HrpAlike helicases involved in DNA replication, recombination and repair. A fragment in proximity to the Cend of the protein represents the HA2 domain (associated with helicases). Its function is unknown but it is supposed to be involved in the process of binding of the protein with nucleic acids.
Discussion
Our analysis of the function of the AtFAS4 gene permits the following conclusions to be made. The gene is likely to be expressed at certain stages of plant development or under the action of some factors that depend on the stage of development and on environmental conditions. Considering the presence in the AtFAS4 protein of domains characteristic of helicases (for which the substrate can be both DNA and RNA), it can be assumed that the synthesis of AtFAS4 mRNA can occur in short periods of plant ontogenesis when it is necessary to activate certain RNA or DNA molecules. Overexpression of the helicase coding gene causes development of a fascinated stem that was also shown in previously published work of Soichi Inagaki with colleagues (Inagaki et al., 2006). This assumption is supported by a short lifetime of the protein and its susceptibility to a large number of peptidases. Thus, cDNA of the AtFAS4 gene has been experimentally obtained for the first time and the mutant phenotype of A.thaliana characterized by the development of fasciated stems under the action of AtFAS4 gene super-expression has been described.
So we would suggest that overexpressing mutants like AtFAS4 can be used as a stand-alone convenient technique for EST and cDNA studying in case of genes that have no or low transcription level in wild type plants.
We thank to Jean-Denis Faure and Francois Roudier from the Cell Biology Laboratory of Versailles INRA for assistance at the initial stages of this work.
ReferencesFeldmannKA1991T-DNA insertion mutagenesis in Arabidopsis. Mutational spectrumPlant Journal17182PogorelkoGVFursovaOVOgarkovaOATarasovVA2007New vector system for induction of gene expression in dicotyledonous plantsGenetika (RUS)43194201PogorelkoGVFursovaOVOgarkovaOATarasovVA2008A new technique for activation tagging in ArabidopsisGene4146775PogorelkoGVFursovaOV2008A highly efficient miPCR method for isolating FSTs from transgenic Arabidopsis thaliana plantsJournal of Genetics87133140WeigelDAhnJHBlazquezMABorevitzJOChristensenSK2000Activation tagging in ArabidopsisPlant Physiology12210031013InagakiSSuzukiTOhtoMUrawaHHoriuchiT2006Arabidopsis TEBICHI, with Helicase and DNA Polymerase Domains, Is Required for Regulated Cell Division and Differentiation in MeristemsPlant Cell18879892AbbreviationsCaMV35S
promoter of 35S ribosomal RNA gene from cauliflower mosaic virus
Col-0
Columbia 0 Arabidopsis thaliana ecotype
FSTs
flanking sequence tags
T-DNA
transferred DNA
TAIR
The Arabidopsis Information Resource
Description of E78 mutant: predicted in silico gene length and putative protein product, localization and amount of insertions.
Line Name
Gene/Length
Protein Description
Localization/Orientation of T-DNA Insertion
GeneBank accession no.
Number of plants, resistant to herbicide in T2 generation
Number of plants, NOT resistant to herbicide in T2 generation
χ2
Amount of insertions
E78
AtFAS4 (AT1G33390) 4371 bp
DEAH-box АТPdependent helicase
Localized in 530bp before Start-Codon. Enhancer directed on Start-Codon
EI183464
139
51
0,56
1
Plant specific transcription factors predictably controlling the At1g33390 gene expression.