| |
Citation: Gennady P, Oksana F, Eugene K (2008) Identification and Analysis of the Arabidopsis Thaliana
Atfas4 Gene Whose Overexpression Results in the Development of A Fasciated Stem. J Proteomics Bioinform 1: 329-335.
|
Copyright: © 2008 Gennady P, etal. This is an open-access article distributed under the terms of the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author
and source are credited.
|
Abbreviations
CaMV35S – promoter of 35S ribosomal RNA gene from
cauliflower mosaic virus
Col-0 – Columbia 0 Arabidopsis thaliana ecotype
FSTs – flanking sequence tags
T-DNA – transferred DNA
TAIR – The Arabidopsis Information Resource
Abstract
Using a new pEnLox vector employed to generate gain-of-function mutants in Arabidopsis thaliana, the AtFAS4
mutant has been obtained and analyzed. The mutant is characterized by super-expression of the At1g33390
gene, which leads to the occurrence of a mutant phenotype – stem fasciation. The level of expression of the
AtFAS4 gene in normally developing A.thaliana plants is extremely low thus accounting for almost complete
absence of information on EST’s of this gene. The generated AtFAS4 mutant has permitted full-length cDNA of
the At1g33390 gene to be obtained and analyzed for the first time.
Keywords
Activation tagging; Arabidopsis thaliana; Full length cDNA; Stem Fasciation
Introduction
Large collections of Arabidopsis thaliana transgenic plants
are presently available with T-DNA or mobile elements used
as insertions and can be found at the following locations;
ABRC (http://www.arabidopsis.org/abrc/), NASC
(http://
nasc.nott.aac.uk/), SALK (http://signal.salk.edu/) and GABI
(http://www.gabi-kat.de/). Most of these collections, however,
are based on insertions causing so-called loss-of-function
mutations related to inactivation of genes carrying insertions
(Feldmann, 1991). Other types of mutations, like
mutations determined by super-expression of genes, are
represented in the available collections rather poorly.
A system of two vectors, pEnLox (DQ645630) and pCre
(DQ635631), has been previously constructed (Pogorelko
et al., 2007). Vector pEnLox contains an enhancer (a tetramer
of the cauliflower mosaic virus 35S RNA promoter)
able to induce super-expression of genes adjacent to the
site of insertion integration and directed to the start-codon,
ith this direction corresponding to the direction of gene transcription.
Eight lines have been obtained with the use of the pEnLox
vector carrying an insertion in such orientation that the enhancer
in the T-DNA structure is directed to the start-codon
of translation of a nearby gene (Pogorelko et al., 2008).
Thus this arrangement is potentially able to cause superexpression
of the nearby gene. Three of the mutant lines
differ by phenotype from wild-type plants. A molecular-genetic
analysis of the E78 line has been carried out and the
mutant plants of this line have been designated as AtFAS4.
Materials and Methods
Plant Material And Growth
Arabidopsis thaliana plants of the Col-0 ecotype were
grown at 21-23°C in normal-day conditions (16 h of light
and 8 h of dark) under Phillips BioLux fluorescent lights.
RNA Purification and cDNA Synthesis
RNA isolated from the plants using a RNA purification
kit (Plant RNA Isolation Reagent, www.invitrogen.com)
served as a template for synthesis of the first cDNA strand
using an Invitrogen kit (5´ RACE System for Rapid Amplification
of cDNA Ends; 3´ RACE System for Rapid Amplification
of cDNA Ends; GeneRacer® Kit with AMV RT
and TOPO TA Cloning® kit for Sequencing)
(www.invitrogen.com).
Identification of full-length cDNA of the At1g33390
gene
Full-length cDNA was synthesized using a special kit from
Evrogen (www.evrogen.ru) strictly following the instructions.
Since AtFAS4 cDNA is more than 4 kb in size, its
amplification was carried out in 5 sequentially overlapping
PCR fragments with the following primers:
Fragment 1 (5’end)
M1 (Evrogen)
At1g33390_Rev1 ACGACAAGTTGTCAGTGGGA
Fragment 2
At1g33390_Forw2 GCAACTGGTTCATGCTGATC
At1g33390_Rev2 GACTCTTTTGTTGTTCCTCG
Fragment 3
At1g33390_Forw3 CTTATTGAGGCGTTATCTTG
At1g33390_Rev3 ACAGTGACCAGGTCCAGTTC
Fragment 4
At1g33390_Forw4 ACTTCTCTGACTATTCCTGG
At1g33390_Rev4 GGAGCTGAGTTTATGAGAGA
Fragment 5 (3'-end)
At1g33390_Forw5 GTGTAGCCAGAAAGACCAGAG
M1 (Evrogen)
Bioinformatic tools
Promoter regions were identified using the
PromoterInspector (http://www.genomatix.de/) and Promoter
Prediction (http://www.fruitfly.org/seq_tools/
promoter.html) programs which allow to predict promoter
egions and initial transcription sites. The MatInspector program
with plant filter (http://www.genomatix.de/) was used
for search of binding sites of transcription factors.
Results
Phenotype And Genotype Of The Mutant
The morphological distinction of the E78 line is a clearly
visible fasciated stem consisting of 7-12 stems (Fig.1). Segregation
analysis showed the mutant trait to be inheritable
in a monogenic fashion (3:1 segregation, 0.56<3.84 for
p=0.05) (Table 1). Southern blot-hybridization demonstrated
the presence of a single T-DNA insertion copy in the genome
of E78 plants (Suppl. fig. 1). The modified inverse
PCR method was used to identify the site of T-DNA insertion
in the genome of E78 line plants (Pogorelko and Fursova,
2008). Sequencing and subsequent analysis in silico of the
obtained DNA fragment allowed us to determine the place
of T-DNA integration in the genome of E78 plants (GenBank
Acc.: EI183464). The insertion is localized in the
precentromeric region of chromosome 1. A more detailed
analysis showed the insertion to precede the start-codon of
the AtFAS4 gene (approximately at a distance of 0.5 kb)
and the enhancer to be oriented to the start-codon. This
enhancer acts at a distance of 380 bp-3.6 kb from the target
gene (Weigel et al., 2000).
Analysis of AtFAS4 expression
Since the mutant phenotype of E78 plants is determined
by the activity of the enhancer contained in T-DNA, we
analyzed AtFAS4 gene expression in 4 independent E78
mutant sub lines (T1 generation plants that had been selected
by “Basta”) and in wild-type plants (Fig.2).
The AtFAS4 gene was found to be expressed in the mutant
plants and not expressed in the wild-type plants. Analysis
of the databases containing information on ESTs demonstrated
the availability of only two experimentally obtained
partial cDNAs from the 3’-region of At1g33390 mRNA
(GenBank Acc.: AU235278 and AU225941) (http://
rarge.gsc.riken.jp/). mRNA of the At1g33390 gene represented
in the databases was obtained by the methods of
computer analysis of the genome (NM_103064).
|
Figure 1: Comparison of the phenotypes of plants E78 and A.thaliana Col0. Age – 7 weeks.
(A) AtFAS4 mutant, (B) Wild-type A.thaliana Col-0 mutant. |
Table1: Description of E78 mutant: predicted in silico gene length and putative protein product,
localization and amount of insertions. |
Analysis of the Genevestigator database (https://
www.genevestigator.eyhz.ch/) containing information on the
expression of genes in different organisms with the use of
the Microarray technology provided information on the expression
of the AtFAS4 gene (Fig.3) using mRNA extracted
from the A.thaliana plants grown under normal conditions.
According to these data, the AtFAS4 gene has a very low
expression as compared to the constitutively expressed“house-keeping” At3g18780 gene whose level of transcription
is characteristic of genes controlled by the CaMV35S
promoter.
Thus, the analysis of information from different databases
confirmed our experimental results.
Analysis of AtFAS4 gene structure
We obtained and analyzed full-length cDNA of the AtFAS4
gene from a mutant plant (EF630362). As a result, the gene
was found to have 8 exons, which is in agreement with the predicted gene model (NM_103064). However the synthesis
of AtFAS4 mRNA in a mutant plant of the E78 line starts
from the promoter of the vector and as a consequence the
point of initiation of AtFAS4 gene transcription remains unknown.
We used “PromoterInspector” and “Promoter predictions”
programs to determine in silico the site of transcription
initiation and 5’-UTR.
Therefore our results permit elaboration of the primary
structure of the AtFAS4 gene that was previously predicted
in silico (NM_103064). The promoter predicted with the
Promoter predictions program corresponds to the promoter
predicted on a Genomatix server. However the transcription
start point predicted with the Promoter predictions program
is at a distance of 15 bp after the start of translation in
the gene model (NM_103064). The start of translation determined
by us is in position 26 from the start of transcription
predicted by the programs. Further analysis of the amino
acid sequence permits our variant of the 5’-region structure
to be considered as more correct.
|
Figure 2: An electrophoregram of RT-PCR products of an AtFAS4 fragment (A) and control Actin-2 ragment (B).
The overall pools of RNA isolated from 4 independent mutant plants and Col-0 wild type Arabidopsis plant were
used as a template for synthesis of the first cDNA strand using an Invitrogen kit (www.invitrogen.com). The RT
products were used as a template for PCR with primers At1g33390_ Forw2 (GCAACTGGTTCATGCTGATC),
At1g33390_Rev2 (GACTCTTTTGTTGTTCCTCG). The actin-2 house-keeping gene was used to normalize the
amount of RNA and to control RNA quality. For the Actin-2 amplifying two primers, Actin-2For
(CTCTCCCGCTATGTATGTCGC) and Actin-2Rev (GAAACCCTCGTAGATTGGCA) were used.
(A) M. 1kb+ Invitrogen DNA marker (B) 1. E78/1-mutant plant
1. E78/1-mutant plant 2. E78/2-mutant plant
2. E78/2-mutant plant 3. E78/3-mutant plant
3. E78/3-mutant plant 4. E78/4-mutant plant
4. E78/4-mutant plant C. Wild-type A.thaliana Col0
C. Wild-type A.thaliana Col0 M. 1kb+ Invitrogen DNA marker
|
|
Figure 3: Comparison of expression of the genes At3g18780 (Housekeeping gene, transcriptional factor with constitutive
expression) (left) and AtFAS4 (right) in wild-type plants. |
Analysis of the promoter, using MatInspector program,
revealed the presence of 12 sites of binding of transcriptional
factors (TF) on the positive chain. These transcriptional
factors belong to 5 TF families characteristic of plants
(Table 2, Fig. 4). The optional parameters used for TF
searching are presented in Table 2.
Table2: Plant specific transcription factors predictably controlling the At1g33390 gene expression. |
|
Figure 4: Promoter region of the AtFAS4 gene with recognition sites of the transcription factors. |
In silico analysis of the At1g33390 amino acid sequence
Comparison of the AtFAS4 amino acid sequence with the
known or predicted proteins showed the presence of two
domains and fragments of two more domains. The omain
of DEXH-box or DEAD-box helicases is located at the Nend
of the protein. It participates in ATP-dependent denaturation
of DNA or RNA. The C-end of the protein contains
the DUF1605 domain. Its function is unknown but it is
always found at the C-end of DEAD-box helicases. A fragment
of the HrpA domain (the central part of the protein) is
found in HrpAlike helicases involved in DNA replication,
recombination and repair. A fragment in proximity to the Cend
of the protein represents the HA2 domain (associated
with helicases). Its function is unknown but it is supposed to
be involved in the process of binding of the protein with
nucleic acids.
Discussion
Our analysis of the function of the AtFAS4 gene permits
the following conclusions to be made. The gene is likely to
be expressed at certain stages of plant development or under the action of some factors that depend on the stage of
development and on environmental conditions. Considering
the presence in the AtFAS4 protein of domains characteristic
of helicases (for which the substrate can be both DNA
and RNA), it can be assumed that the synthesis of AtFAS4
mRNA can occur in short periods of plant ontogenesis when
it is necessary to activate certain RNA or DNA molecules.
Overexpression of the helicase coding gene causes development
of a fascinated stem that was also shown in previously
published work of Soichi Inagaki with colleagues
(Inagaki et al., 2006). This assumption is supported by a
short lifetime of the protein and its susceptibility to a large
number of peptidases. Thus, cDNA of the AtFAS4 gene
has been experimentally obtained for the first time and the
mutant phenotype of A.thaliana characterized by the development
of fasciated stems under the action of AtFAS4 gene
super-expression has been described.
So we would suggest that overexpressing mutants like
AtFAS4 can be used as a stand-alone convenient technique
for EST and cDNA studying in case of genes that have no
or low transcription level in wild type plants.
Acknowledgements
We thank to Jean-Denis Faure and Francois Roudier from
the Cell Biology Laboratory of Versailles INRA for assistance
at the initial stages of this work.
Reference
-
Feldmann KA (1991) T-DNA insertion mutagenesis in
Arabidopsis. Mutational spectrum. Plant Journal 1: 71-
82.
-
Pogorelko GV , Fursova OV, Ogarkova OA, Tarasov VA
(2007) New vector system for induction of gene expression
in dicotyledonous plants. Genetika (RUS)
43:194-201.
-
Pogorelko GV , Fursova OV, Ogarkova OA, Tarasov VA
A new technique for activation tagging in Arabidopsis.
Gene. 2008. v. 414, ¹1-2, p. 67-75. [ FIND THIS ARTICLE ONLINE ]
-
APogorelko GV and Fursova OV. A highly efficient
miPCR method for isolating FSTs from transgenic
Arabidopsis thaliana plants. Journal of Genetics 2008.
v. 87, ¹ 2, p.133-140. [ FIND THIS ARTICLE ONLINE ]
-
Weigel D , Ahn JH, Blazquez MA, Borevitz JO,
Christensen SK, etal. (2000) Activation tagging in
Arabidopsis. Plant Physiology 122: 1003-13. [ FIND THIS ARTICLE ONLINE ]
-
Inagaki S , Suzuki T, Ohto M, Urawa H, Horiuchi T,
etal. (2006) Arabidopsis TEBICHI, with Helicase and
DNA Polymerase Domains, Is Required for Regulated
Cell Division and Differentiation in Meristems. Plant
Cell 18: 879–892. [ FIND THIS ARTICLE ONLINE ]
Top
|
|
